View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20371_high_6 (Length: 293)
Name: NF20371_high_6
Description: NF20371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20371_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 5 - 188
Target Start/End: Original strand, 42296195 - 42296378
Alignment:
| Q |
5 |
tgacatggggccgcgagtttatactgatgaggaagagcgagaggcggccatcaattatttgaaaaattgtaatgctcttatggaagagccctttaataag |
104 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
42296195 |
tgacatgaggccgcgagtttataccgatgaggaagagcgagaggcggccatcaattatttgaaaaattataatgctcttatggaagagccctttaatgag |
42296294 |
T |
|
| Q |
105 |
gtggtttccaaggccaagaaaaagaacaagcataagggttttcaggttcataatacccgctataggggaaggttaccagattga |
188 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42296295 |
gtggtttccaatgccaagaaaaagaacaagcataagggttttcaggttcataatacccgctataggggtaggttaccagattga |
42296378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 160
Target Start/End: Complemental strand, 29170312 - 29170173
Alignment:
| Q |
21 |
gtttatactgatgaggaagagcgagaggcggccatcaattatttgaaaaattgtaatgctcttatggaagagccctttaataaggtggtttccaaggcca |
120 |
Q |
| |
|
||||| |||||||||||||| |||||||||| |||| |||||||| ||| || |||| | ||||||||||| | | | ||||| || ||||||| |
|
|
| T |
29170312 |
gtttacactgatgaggaagatagagaggcggcaatcatatatttgaagaatcgttctgctgccacagaagagcccttcactgaagtggtgtctaaggcca |
29170213 |
T |
|
| Q |
121 |
agaaaaagaacaagcataagggttttcaggttcataatac |
160 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
29170212 |
cgaaaaagaagaagcagaagggttttcaggttcataatac |
29170173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 120 - 188
Target Start/End: Complemental strand, 21977703 - 21977635
Alignment:
| Q |
120 |
aagaaaaagaacaagcataagggttttcaggttcataatacccgctataggggaaggttaccagattga |
188 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||| ||| || ||| ||||||||||||||| |
|
|
| T |
21977703 |
aagaaaaagaaaatacataagggttttcaggttcataatacctgctctaagggtaggttaccagattga |
21977635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University