View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20371_low_15 (Length: 238)
Name: NF20371_low_15
Description: NF20371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20371_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 5979233 - 5979019
Alignment:
| Q |
1 |
tcaaagttggggacaagtttagcttcatttttatgaacgttggctccaacaacggtgatttcttagggaagtgagaaaccaaaaagtttttaatttagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5979233 |
tcaaagttggggacaagtttagcttcatttttatgaacgttggctccaacaatagtgatttcttagggaagtgagaaaccacaaagtttttaatttagca |
5979134 |
T |
|
| Q |
101 |
atattnnnnnnnnnnnnnnnnnngaaagggttgtgatttgaatttgtagaagattcacctttgtttaaagtcacttggaataatttagttttattgaaga |
200 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
5979133 |
atatt--------agagagagaggaaagggttatgatttgaatttgtagaagattcacctttgtttaaggtcacttggaataatttagtttcattgaaga |
5979042 |
T |
|
| Q |
201 |
ttcaccgttgcatggagattact |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5979041 |
ttcaccgttgcatggagattact |
5979019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University