View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20371_low_17 (Length: 232)
Name: NF20371_low_17
Description: NF20371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20371_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 113 - 214
Target Start/End: Complemental strand, 32278780 - 32278679
Alignment:
| Q |
113 |
ttgtgaggatgaaggaaaggaatatgagatatacaatataatcaatgcaaaatagaactcagaagaactaaaactcaaaggaaaaaatggcaatgaaaga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32278780 |
ttgtgaggatgaaggaaaggaatatgagatatacaatataatcaatgcaaaatagaactcagaagaactaaaactcaaaggacaaaatggcaatgaaaga |
32278681 |
T |
 |
| Q |
213 |
aa |
214 |
Q |
| |
|
|| |
|
|
| T |
32278680 |
aa |
32278679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University