View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20371_low_20 (Length: 209)

Name: NF20371_low_20
Description: NF20371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20371_low_20
NF20371_low_20
[»] chr2 (1 HSPs)
chr2 (1-194)||(11103600-11103789)


Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 11103789 - 11103600
Alignment:
1 agcattcattttttccttgcaaacatgattaggcttcttttataatagacgaattaaggaatcgatcgaacctatatttcttctttggtaaagaactttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
11103789 agcattcattttttccttgcaaacatgattaggcttcttttatcatagacgaattaaggaatagatcgaacctatatttcttctttggtaaagaactttg 11103690  T
101 gctactaactttttcaacaccatatcagtatagtnnnnnnnngttcaaaattagcattatatatagtgttcaattcaaagaaaaagtcggttgt 194  Q
    ||||||||||||||||||||||||||||||||||        ||||||||||| |||    |||||||||||||||||||||||||||||||||    
11103689 gctactaactttttcaacaccatatcagtatagtaaaaaaaagttcaaaattaacat----tatagtgttcaattcaaagaaaaagtcggttgt 11103600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University