View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20371_low_20 (Length: 209)
Name: NF20371_low_20
Description: NF20371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20371_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 11103789 - 11103600
Alignment:
| Q |
1 |
agcattcattttttccttgcaaacatgattaggcttcttttataatagacgaattaaggaatcgatcgaacctatatttcttctttggtaaagaactttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11103789 |
agcattcattttttccttgcaaacatgattaggcttcttttatcatagacgaattaaggaatagatcgaacctatatttcttctttggtaaagaactttg |
11103690 |
T |
 |
| Q |
101 |
gctactaactttttcaacaccatatcagtatagtnnnnnnnngttcaaaattagcattatatatagtgttcaattcaaagaaaaagtcggttgt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11103689 |
gctactaactttttcaacaccatatcagtatagtaaaaaaaagttcaaaattaacat----tatagtgttcaattcaaagaaaaagtcggttgt |
11103600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University