View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20371_low_9 (Length: 284)
Name: NF20371_low_9
Description: NF20371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20371_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 261
Target Start/End: Complemental strand, 30769898 - 30769655
Alignment:
| Q |
18 |
ggaagctggtacttgagagtaaagggtcttccattgagaattgttctcgaaaggcgtgaacataggtctctcagagaagaactgcgatccacgaccacga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769898 |
ggaagctggtacttgagagtaaagggtcttccattgagaattgttctcgaaagacgcgaacataggtctctcagagaagaactgcgatccacgaccacga |
30769799 |
T |
|
| Q |
118 |
ttctggtgtcaccgcctacataacataaagacttatcgtgagggcgcggcattatgtggcctccgtagctgcacatgagccgaagcttgcctccggggac |
217 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30769798 |
ttctggtgtcaccacctacataacatagagacttatcatgagggcgcggcattatgtggcctccgtagctgcacattagccgaagcttgcctccggggac |
30769699 |
T |
|
| Q |
218 |
attagggaaggaatcgtcgttcattgtttcattaacgcgtgatc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769698 |
attagggaaggaatcgtcgttcattgtttcattaacgcgtgatc |
30769655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University