View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20372_low_12 (Length: 253)
Name: NF20372_low_12
Description: NF20372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20372_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 17 - 117
Target Start/End: Complemental strand, 31582768 - 31582668
Alignment:
| Q |
17 |
agaagtgtcaaaaatcaggtggactttgtggttataactggacttcaaggcaaacaacctgctactgcagagaccagtcttgttccaatgcacagtctca |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||| || |||| ||||||||| |
|
|
| T |
31582768 |
agaagtgtcaaaaatcaggtggattttgtggttataactggacttcaaggcaaacaacctgttactgtggagaccaaccttgctctaatggacagtctca |
31582669 |
T |
 |
| Q |
117 |
a |
117 |
Q |
| |
|
| |
|
|
| T |
31582668 |
a |
31582668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 17 - 176
Target Start/End: Complemental strand, 31641374 - 31641194
Alignment:
| Q |
17 |
agaagtgtcaaaaatcaggtggactttgtggttataactggacttcaaggcaaacaacctgctactgcagagaccagtcttgttccaatg------caca |
110 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||| |||| |||| |
|
|
| T |
31641374 |
agaagtgtcaaaaatcaggtggattttgtggttataactggacttcaaggcaaacaacctgttactgtggagaccaaccttgttctaatgaacctccaca |
31641275 |
T |
 |
| Q |
111 |
gtctca---------------aggtatgtctaaagatttttgctaattgctaattgcattttctattctctataaaatgat |
176 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||| |
|
|
| T |
31641274 |
atctcaagaatctccatcttcaggtatgtctaaagatttttgctaaatgctatttgcattttctgttctctataaaatgat |
31641194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University