View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20372_low_13 (Length: 227)
Name: NF20372_low_13
Description: NF20372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20372_low_13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 27 - 227
Target Start/End: Original strand, 21820433 - 21820633
Alignment:
| Q |
27 |
tagcaatgattgataagcaagggggagnnnnnnnttgatgacatttctcctctcttcctttgatagtctcttgtattttagcattctagtacttatatta |
126 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
21820433 |
tagcaatgattgataagcaaaggggagaaaaaaattgatgacatttctcctctcttcctttgatagtctcttgtattttagtattctagtatttatatta |
21820532 |
T |
|
| Q |
127 |
tattccacgagtggattaatttcatcttacttttatatctggttttattgtaatttcatatactctttatttaatccaaattgcataatatccatccatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21820533 |
tattccacgagtggattaatttcatcttacttttatatctggttttattgtaatttcatatactctttatttaatccaaattgcataatatccatccatt |
21820632 |
T |
|
| Q |
227 |
c |
227 |
Q |
| |
|
| |
|
|
| T |
21820633 |
c |
21820633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University