View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20372_low_2 (Length: 582)
Name: NF20372_low_2
Description: NF20372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20372_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 2e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 359 - 536
Target Start/End: Original strand, 41654778 - 41654957
Alignment:
| Q |
359 |
aagagaatgtcacaactatcaatttggtttatggggtaagactcctaaaaagaatttgtacatttcacaagtatgcataaactcttgattcaa--taaat |
456 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41654778 |
aagagaatgtcacaactatcgatttggtttatggggtaagactcctaaaaagaatttgtacatttcacaagtatgcataaactcttgattcaatctaaat |
41654877 |
T |
 |
| Q |
457 |
cacatagtgatcttaactcacttaaattgaagggtgagtatatctttatttgcatcttttaacaagatcattttagagga |
536 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
41654878 |
cacattgtgatcttaactcacttaaattgaagggtgaatatatctttatatgcatcttttaacaagagcattttagagga |
41654957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 495 - 536
Target Start/End: Original strand, 41183547 - 41183588
Alignment:
| Q |
495 |
tatatctttatttgcatcttttaacaagatcattttagagga |
536 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
41183547 |
tatatctttatctgcatcttttaacaagataattttagagga |
41183588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University