View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20372_low_9 (Length: 334)
Name: NF20372_low_9
Description: NF20372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20372_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 17 - 328
Target Start/End: Complemental strand, 21821125 - 21820814
Alignment:
| Q |
17 |
atttacttctctgtcttattatttttgttattatctcttctttagttgcagctgatattcatgttcctccgcctcctattccaagtaaatcattctctag |
116 |
Q |
| |
|
||||| ||||||||||| || ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21821125 |
atttatttctctgtcttgttttttttgttattatcttttctctagttgcagctgatattcatgttcctccgcctcctattccaagtaaatcaatctctag |
21821026 |
T |
 |
| Q |
117 |
cctataatttatttttctaagtcaaatacatatgtttgaataatttaatgcatattcaattatatttcaccaaatattcgatatcacaaacacatccttc |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21821025 |
cctataatttatttttctaagttaaatacatatgtttgaataatttaatgcatattcaattatatttcaccaaatattcgatatcacaaacacatccttc |
21820926 |
T |
 |
| Q |
217 |
tcctcttatcttctttctcttttgcagagataaatctttctccaatgattaatccacttactgataaacaaatctcagcttttgacaaggaccaagatgg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21820925 |
tcctcttatcttctttctcttttgcagagataaatctttctccaatgattaatccacttactgataaacaaatctcagcttttgacaaggaccaagatgg |
21820826 |
T |
 |
| Q |
317 |
tttcttctctgc |
328 |
Q |
| |
|
|||||||||||| |
|
|
| T |
21820825 |
tttcttctctgc |
21820814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University