View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20373_low_7 (Length: 310)
Name: NF20373_low_7
Description: NF20373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20373_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 38126267 - 38125978
Alignment:
| Q |
1 |
ccataaataagttaaaaggattttatgtctaatagtaacaagcattacaagcaatgaatacaaacaataatgaccagtatagtatacctcaacgacagat |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
38126267 |
ccataaataaattaaaaggattttatgtctaatagtaataagcattacaagcaatgaatacagacaataatgac-----tagtatacctcaacgacagat |
38126173 |
T |
 |
| Q |
101 |
atgttatttaaaagatcataaaactcttctaagagttgcttctcttgtgtaataacttttgccaattctgatagtattgcagcagtttggtcaacctgtt |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38126172 |
atgttatgtaaaagatcataaaactcttctaagagttgcttctcttgtgtaacaacttttgccaattctgatagtattgcagcagtttggtcaacctgtt |
38126073 |
T |
 |
| Q |
201 |
gacagataaatttttccacatgaatgcagccctcatagatagcaaaagagaaatgatatctcgacacaaaatttgacaacaatttggattgttaa |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38126072 |
gacagataaatttttccacatgaatgcagccctcatagatagcaaaagagaaatgatatctcgacacaaaatttgacaacaatttggattgttaa |
38125978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University