View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20376_low_14 (Length: 331)
Name: NF20376_low_14
Description: NF20376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20376_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 5 - 291
Target Start/End: Complemental strand, 8885057 - 8884775
Alignment:
| Q |
5 |
tagataattctatttgaatgtaacaaaataataataattctattcaagacgtgtcggtactaaatgtaaatattaattttatatttgagccttgatatgc |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8885057 |
tagataattctatttgaatgtaacaaaataataataattctattcaagatgtgccggtactaaatgtaaatattaattttatatttgagccttgatatgc |
8884958 |
T |
 |
| Q |
105 |
gatattgtgagagtctagctcattccgttagacgatattgtgagagtctaactctttccgttagattgaacttgttgatcgtttttaacgggttttattg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8884957 |
gatattgtgagagtctagctcattccgttagacgatattgtaagagtctaactcattccattagattgaacttgttgatcgtttttaacgggttttattg |
8884858 |
T |
 |
| Q |
205 |
tatatataagttagaaatgtgaaggtcatttggtgcatttatctataccatcattatgtaaatgaaacttgaaaggtaacttctctc |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8884857 |
tatatataagttagaaatgtgaaggtcatttggtgcatttatctatac---cattatgtaaatg-aacttgaaaggtaacttctctc |
8884775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University