View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20376_low_15 (Length: 320)
Name: NF20376_low_15
Description: NF20376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20376_low_15 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 138 - 320
Target Start/End: Complemental strand, 41130942 - 41130760
Alignment:
| Q |
138 |
tgctaacctagtttacctcctctttgatatcgtctccaaatcataattactattatagtctcttccttcaaaacggtacgttccatctttcttatttggt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41130942 |
tgctaacctagtttacctcctctttgatatcgtctccaaatcataattactattatagtctcttccttcaaaacggtacgttccatctttcttatttaat |
41130843 |
T |
|
| Q |
238 |
tttaataattatattgatcgatctgtccttttatctttaaccttcatgtttctaagaaaaggatattggtgatccaaatttta |
320 |
Q |
| |
|
||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41130842 |
ttttataattatattgatcgatttgtccttttatctttaaccttcatgtttctaagaaaaggatattggtgatccaaatttta |
41130760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 11 - 67
Target Start/End: Complemental strand, 41131069 - 41131013
Alignment:
| Q |
11 |
gagcagagatgctagtggtgttaattataggctctccctttgcaataattctcacaa |
67 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41131069 |
gagcaaagatgctagtggtgttaattataggctctccctttgcaataattctcacaa |
41131013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University