View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20376_low_8 (Length: 396)
Name: NF20376_low_8
Description: NF20376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20376_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 175 - 383
Target Start/End: Complemental strand, 30762184 - 30761976
Alignment:
| Q |
175 |
ttgtaggataatggttcatttaacaatcatatgattgtatacttttaaattaactttagatcaataatgaaatcatagaaagaaactaacctttttcaag |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30762184 |
ttgtaggataatggttcatttaacaatcatatgattgtatacttttaaattaactttagatcaataatgaaatcatagaaagaaactaacctttttcaag |
30762085 |
T |
 |
| Q |
275 |
ccaggtatcatggctgaaagtgctatgatattctcagttaattcccttctccttttcctctcagccatcaaatgatcttgtactgtctcacatgatcttc |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30762084 |
ccaggtatcatggctgaaagtgctatgatattctcagttaattcccttctccttttcctctcagccatcaaatgatcttgtactgtctcacatgatcttc |
30761985 |
T |
 |
| Q |
375 |
taaccttct |
383 |
Q |
| |
|
||||||||| |
|
|
| T |
30761984 |
taaccttct |
30761976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 30762359 - 30762311
Alignment:
| Q |
1 |
tggcttatgttattagtaatattcgtgagacagagttcaaatcccataa |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30762359 |
tggcttatgttattagtaatattcgtgagacagagttcaaatcccataa |
30762311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University