View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20377_low_2 (Length: 502)
Name: NF20377_low_2
Description: NF20377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20377_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 249
Target Start/End: Original strand, 48225913 - 48226151
Alignment:
| Q |
11 |
cagagaccgaaggaggttacggtggccggagaagaagtttcaagcgaatcttgcgatgcggagtcatcagtggatgaagggtccacaacgacgtcgtcta |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48225913 |
cagaaaccgaaggaggttacggtggccggagaagaagtttcaagcgaatcttgcgatgcggagtcatcagtggatgaagggtccacaacgacgtcgtcta |
48226012 |
T |
|
| Q |
111 |
cttcatcacccaaaacgacggcgttgaaggaatggaatggagtgagagaattagcggcgggaaataaaggattagtgggttcaggattcttatgctgttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48226013 |
cttcatcacccaaaacgacggcgttgaaggaatggaatggagtgagagaattatcggcgggaaataaaggattagtgggttcaggattcttatgctgttt |
48226112 |
T |
|
| Q |
211 |
ggttgcacagaggaatagcaatatcagcaggtaacagtg |
249 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48226113 |
ggttgcacagaggaatagccatatcagcaggtaacagtg |
48226151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 272 - 485
Target Start/End: Original strand, 48226176 - 48226393
Alignment:
| Q |
272 |
ctactctatgattagtggtagtttatatagtgtaatcagactttgatggacggtggagattctcctggaaaatttagagtcaaatttagcaacatttttt |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48226176 |
ctactctatgattagtggtagtttatatagtgtaatcagactttgatggacggtggagattctcctggaaaatttagagtcaaatttagcaacatttttt |
48226275 |
T |
|
| Q |
372 |
cccatgctttgggactattatgtagtaattcagtccctattatcttttgttgttgtagtaaagtagagtacactacact---ctgt-ttttcaagttttt |
467 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||| |
|
|
| T |
48226276 |
cccatgctttgggactattatgtagtaattcagtccctattatcttttgttgttgtagtaaagtagagtacactacactacactctgttttcaagttttt |
48226375 |
T |
|
| Q |
468 |
tacttgttgctttttagt |
485 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48226376 |
tacttgttgctttttagt |
48226393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University