View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20378_high_20 (Length: 309)
Name: NF20378_high_20
Description: NF20378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20378_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 223 - 280
Target Start/End: Original strand, 34899918 - 34899975
Alignment:
| Q |
223 |
gagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899918 |
gagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
34899975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 185
Target Start/End: Original strand, 11556958 - 11557002
Alignment:
| Q |
141 |
tggttacattcaaacacttcaatttactcaaattattacaggtgt |
185 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||||||||||||| |
|
|
| T |
11556958 |
tggttacattcaatcacttaaattttctcaaattattacaggtgt |
11557002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 29587725 - 29587669
Alignment:
| Q |
141 |
tggttacattcaaacacttcaatttactcaaattattacaggtgtttacgtgtcagt |
197 |
Q |
| |
|
|||||||||| || |||||| |||| || |||||||||| |||||||||||| |||| |
|
|
| T |
29587725 |
tggttacatttaatcacttccattttcttaaattattaccggtgtttacgtgacagt |
29587669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 144 - 200
Target Start/End: Complemental strand, 30271732 - 30271676
Alignment:
| Q |
144 |
ttacattcaaacacttcaatttactcaaattattacaggtgtttacgtgtcagtatc |
200 |
Q |
| |
|
|||||||||| |||||| || | || |||| ||||| |||||||||||||||||||| |
|
|
| T |
30271732 |
ttacattcaatcacttctatattcttaaatcattactggtgtttacgtgtcagtatc |
30271676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University