View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20379_high_1 (Length: 498)
Name: NF20379_high_1
Description: NF20379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20379_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 470; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 470; E-Value: 0
Query Start/End: Original strand, 19 - 496
Target Start/End: Complemental strand, 45709905 - 45709428
Alignment:
| Q |
19 |
aaagaaacataacttattaggaatatacctacaaagatcttggattgttctgttcctttgttgttttttactgttgccgttttatatctttgccactcca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45709905 |
aaagaaacataacttattaggaatatacctacaaagatcttggattgttctgttcctttgttgttttttactgttgccgttttatatctttgccactcca |
45709806 |
T |
 |
| Q |
119 |
attctcaaacttctaggacaacctgatgacgtggcagaatggagtggtattgtggctatctggcttatacctttgcatttcagttttgcatttcagtttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45709805 |
attctcaaacttctaggacaacctgatgacgtggcagaatggagtggtattgtggctatctggcttatacctttgcatttcagttttgcatttcagtttc |
45709706 |
T |
 |
| Q |
219 |
ctcttcagaggtttctacaatgccagctgaaaacaggtgtgattgcttgggtttctttggttggtttggtggtaaatgtggtgcttagttggctgttgat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45709705 |
ctcttcagaggtttctacaatgccagctgaaaactggtgtgattgcttgggtttctttggttggtttggtggtaaatgtggtgcttagttggctgttgat |
45709606 |
T |
 |
| Q |
319 |
ttttgtttgggattttggacttattggtgctgctattgctttggatgtttcttggtggattttggtttttgggatgttggcttatactgtttgtggtggg |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45709605 |
ttttgtttgggattttggacttattggtgctgctattgctttggatgtttcttggtggattttggtttttgggatgttggcttatactgtttgtggtggg |
45709506 |
T |
 |
| Q |
419 |
tgtcctttaacttggactggtttttcaattgaagccttttctggtctttgggatttcttcaaactctcctttgcttct |
496 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45709505 |
tgtcctttaacttggactggtttttcaattgaagccttttctggtctttgggatttcttcaaactctcttttgcttct |
45709428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University