View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20379_high_2 (Length: 463)
Name: NF20379_high_2
Description: NF20379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20379_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 189 - 451
Target Start/End: Complemental strand, 24453833 - 24453564
Alignment:
| Q |
189 |
ctccctaacacttcccaaaggttcaaccaaacccgcagaaagccttcgaaaaatttgttgaagcgccgggtcttcaatccacctatccaaccaaaataaa |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24453833 |
ctccctaacacttcccaaaggttcaaccaaacccgcagaaagccttcgaaaaatttgttgaagcgccgggtctccaatccacctatccaaccaaaataaa |
24453734 |
T |
|
| Q |
289 |
gtttacgaaacatactaatcaaatagctccatgtcgaagctttcccctagtttcaaatatccagggnnnnnnngtgaaagaatacagcacaaaatccacc |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |||||| ||||||||||||| |
|
|
| T |
24453733 |
gtttacgaaacatactaatcaaatagctccatgtcgaagctttcccctagtttcaaacatccagggaaaaaaagtgaaataatacaacacaaaatccacc |
24453634 |
T |
|
| Q |
389 |
atcatgtttcttaaataata-------accccccaaacttacacaaggagacatacattataaagatatt |
451 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24453633 |
atcatgtttcttaaataataaccccccaccccccaaacttacacaaggggacatacattataaagatatt |
24453564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University