View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20379_high_6 (Length: 351)
Name: NF20379_high_6
Description: NF20379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20379_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 17 - 335
Target Start/End: Original strand, 4701468 - 4701786
Alignment:
| Q |
17 |
atgaacttcatcttttgagcttgtttcatctgtccttcattaagatcatactgcagcaaccaaccactttcaagcatcttgttcatacgaacttgttgta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4701468 |
atgaacttcatcttttgagcttgtttcatctgtccttcattaagatcatactgcagcaaccaaccactttcaaacatcttgttcatacgaacttgttgta |
4701567 |
T |
|
| Q |
117 |
tttattcccttgttcaagtggatgaaacaaactcaatggagcaagttatgagtatcattcatgtaaccatagattagcggcggcatatgctgttttgtta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4701568 |
tttattcccttgttcaagtggatgaaacaaactcaatggagcaagttatgagtatcattcatgtaaccatagattagcggcggcatatgctgttttgtta |
4701667 |
T |
|
| Q |
217 |
gtatgcagtgacatctaaacattctagaaagtgatgtttcatgttattgtttttgtgtgcattcaatcgaaattcattcaaataataacccgtctaacgg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4701668 |
gtatgcagtgacatctaaacattctagaaagtgatgtttcatgttattgtttttgtgtgcattcaatcgaaattcattcaaataataacccgtctaacgg |
4701767 |
T |
|
| Q |
317 |
gagaaatatatctacttag |
335 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4701768 |
gagaaatatatctacttag |
4701786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University