View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2037_high_17 (Length: 269)
Name: NF2037_high_17
Description: NF2037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2037_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 43094313 - 43094077
Alignment:
| Q |
1 |
ctttgcatgagaattggaaatattccttgcaaatgaaggtaacgtgcccttgtgagaagagaaggaaaggacaaaaggagggaaggnnnnnnnncttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43094313 |
ctttgcatgagaattggaaatattccttgcaaatgaaggtaacgtgcccttgtgagaagagaaggaaaggacaaaaggagggaaggaaaaaaaacttcaa |
43094214 |
T |
|
| Q |
101 |
cagaaacaattgttacagcaaggattgggtgtcagattatgtggggccctatacggattgtttgtagtaactcctaattttaacgttaatgaaaacnnnn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43094213 |
cagaaacaattgttacagcaaggattgggtgtcagattatgtggggccctatacggattgtttgtagtaactcctaattttaacgttaatgaaaac--aa |
43094116 |
T |
|
| Q |
201 |
nnnnnncatctaacaatataacaacctcctttcgttgtc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43094115 |
aaaaaccatctaacaatataacaacctcctttcgttgtc |
43094077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University