View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2037_low_18 (Length: 272)
Name: NF2037_low_18
Description: NF2037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2037_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 19 - 259
Target Start/End: Complemental strand, 3469782 - 3469542
Alignment:
| Q |
19 |
cttaacgccatcaagaaacacgctgaatcctacatcagcgtttggaattgtcaccattccatcaacagaaaacctcctcaaaccctaatcaaagaggact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469782 |
cttaacgccatcaagaaacacgctgaatcctacatcagcgtttggaattgtcaccattccatcaacagaaaacctcctcaaaccctaatcaaagaggact |
3469683 |
T |
 |
| Q |
119 |
ttgaatttcattgcaaatgtatcggaaaagtttgcatggtcgatattatttgtttcctttgcaaaccggagaatctctcttccccggccgcagctcttcg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469682 |
ttgaatttcattgcaaatgtatcggaaaagtttgcatggtcgatattatttgtttcctttgcagaccggagaatctctcttccccggccgcagctcttcg |
3469583 |
T |
 |
| Q |
219 |
gtctccagtttcgattcttcttgcagacgaccgttcatctc |
259 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3469582 |
gtctccagttccgattcttcttgcagacgaccgttcatctc |
3469542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 145 - 194
Target Start/End: Complemental strand, 33554778 - 33554729
Alignment:
| Q |
145 |
aaagtttgcatggtcgatattatttgtttcctttgcaaaccggagaatct |
194 |
Q |
| |
|
|||||||||||||| ||| ||||||||| |||||||||||| || ||||| |
|
|
| T |
33554778 |
aaagtttgcatggttgatgttatttgttacctttgcaaaccagaaaatct |
33554729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University