View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2037_low_19 (Length: 270)
Name: NF2037_low_19
Description: NF2037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2037_low_19 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 7 - 270
Target Start/End: Complemental strand, 44110325 - 44110063
Alignment:
| Q |
7 |
tgtccaagaatataaactagtataaattgattcagttcatgaaatgcaaaccccataaattattgttgaaggaagctatttaacttaaccgcgccttatt |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44110325 |
tgtccaataatataaactagtataaattgattcagttcatgaaatgcaaaccccataaattattgttgaaggaagctatttaacttaaccgcgccttatt |
44110226 |
T |
|
| Q |
107 |
aaagttagacaagaaaattcaattcctactnnnnnnnntatttacttaaactgaatgtctcatcttctcatgtctgcaagttgattcttgacatccgcca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44110225 |
aaagttagacaagaaaattcaattcctact-aaaaaaatatttacttaaactgaatgtctcatcttctcatgtctgcaagttgattcttgacatccgcca |
44110127 |
T |
|
| Q |
207 |
ggttcttcaaaggcacaccatgtggtaaaaatggcgaacaggtaatctcgatctgctttaaaac |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44110126 |
ggttcttcaaaggcacaccatgtggtaaaaatggcgaacaggtaatctcgatcagctttaaaac |
44110063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 40450213 - 40450254
Alignment:
| Q |
170 |
cttctcatgtctgcaagttgattcttgacatccgccaggttc |
211 |
Q |
| |
|
|||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
40450213 |
cttcccatgcctgcaagttggttcttgacatccgccaggttc |
40450254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 40507017 - 40507058
Alignment:
| Q |
170 |
cttctcatgtctgcaagttgattcttgacatccgccaggttc |
211 |
Q |
| |
|
|||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
40507017 |
cttcccatgcctgcaagttggttcttgacatccgccaggttc |
40507058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University