View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2037_low_24 (Length: 240)
Name: NF2037_low_24
Description: NF2037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2037_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 19 - 121
Target Start/End: Complemental strand, 43094549 - 43094447
Alignment:
| Q |
19 |
attcaaacctgatcttttttagaatcagaaatgaaaagtttcttcacagcagaaaaccaacttcctttcctccccatgtgcaatttcctttatcttgatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43094549 |
attcaaacctgatcttttttagaatcagaaatgaaaagtttcttcaccgcagaaaaccaacttcctttcctccccatgtgcaatttcctttatcttgatg |
43094450 |
T |
|
| Q |
119 |
atg |
121 |
Q |
| |
|
||| |
|
|
| T |
43094449 |
atg |
43094447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 195 - 240
Target Start/End: Complemental strand, 43094373 - 43094328
Alignment:
| Q |
195 |
tattgatgataaaactaaaggatcaagaattaatagaggagaggcc |
240 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43094373 |
tattgataataaaactaaaggatcaagaattaatagaggagaggcc |
43094328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University