View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2037_low_26 (Length: 205)

Name: NF2037_low_26
Description: NF2037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2037_low_26
NF2037_low_26
[»] chr1 (2 HSPs)
chr1 (21-175)||(12826149-12826303)
chr1 (67-116)||(12826478-12826527)


Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 21 - 175
Target Start/End: Complemental strand, 12826303 - 12826149
Alignment:
21 gaagctttgtggttttgattatggtacagtatttgtgttttagtgtttagtatgattgtcatgaatcttgtgattgacttttgatttcatgtgtcataca 120  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
12826303 gaagctttgtggttttgattatggtacagtatttgtgctttagtgtttagtatggttgtcatgaatcttgtgattgacttttgatttcatgtgtcataca 12826204  T
121 gccatattggcagatgagatgggccttggcaaaacggttcaggtgtgttgtcctg 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12826203 gccatattggcagatgagatgggccttggcaaaacggttcaggtgtgttgtcctg 12826149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 67 - 116
Target Start/End: Complemental strand, 12826527 - 12826478
Alignment:
67 ttagtatgattgtcatgaatcttgtgattgacttttgatttcatgtgtca 116  Q
    |||| ||| |||||||||||||  || |||||||||||||||||||||||    
12826527 ttagcatggttgtcatgaatctcttgtttgacttttgatttcatgtgtca 12826478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University