View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2037_low_26 (Length: 205)
Name: NF2037_low_26
Description: NF2037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2037_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 21 - 175
Target Start/End: Complemental strand, 12826303 - 12826149
Alignment:
| Q |
21 |
gaagctttgtggttttgattatggtacagtatttgtgttttagtgtttagtatgattgtcatgaatcttgtgattgacttttgatttcatgtgtcataca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12826303 |
gaagctttgtggttttgattatggtacagtatttgtgctttagtgtttagtatggttgtcatgaatcttgtgattgacttttgatttcatgtgtcataca |
12826204 |
T |
 |
| Q |
121 |
gccatattggcagatgagatgggccttggcaaaacggttcaggtgtgttgtcctg |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12826203 |
gccatattggcagatgagatgggccttggcaaaacggttcaggtgtgttgtcctg |
12826149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 67 - 116
Target Start/End: Complemental strand, 12826527 - 12826478
Alignment:
| Q |
67 |
ttagtatgattgtcatgaatcttgtgattgacttttgatttcatgtgtca |
116 |
Q |
| |
|
|||| ||| ||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
12826527 |
ttagcatggttgtcatgaatctcttgtttgacttttgatttcatgtgtca |
12826478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University