View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2037_low_7 (Length: 406)
Name: NF2037_low_7
Description: NF2037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2037_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 2e-68; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 238 - 401
Target Start/End: Original strand, 43027413 - 43027576
Alignment:
| Q |
238 |
aatgaaggacatctcactttggtgccccacctatcttcgatacggatgttgaacttccctaaccctacaaaaaccaatgttacccaacaaccgtgtttta |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||| |
|
|
| T |
43027413 |
aatgaaggacatctcactttggtgccccacctatcttcgatacggatgttgaacttccctaaccctacaaaaatcaatgttacccaagaaccaagtttta |
43027512 |
T |
|
| Q |
338 |
tgttgtaaaagtcgcgtagagcacgccagcctttggtaaagaagatgccatagttgtttctctg |
401 |
Q |
| |
|
||||||||||| ||||||||||| ||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43027513 |
tgttgtaaaagccgcgtagagcatgccggcctttggtaaagaagatgccacagttgtttctctg |
43027576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 93 - 174
Target Start/End: Original strand, 41395114 - 41395195
Alignment:
| Q |
93 |
tccagtctcaatttcagctgcagtaagtgttttctcgtatgtcacttgaaagttaaactcattatgagtaaaaggccttgga |
174 |
Q |
| |
|
||||| |||||||||||| | ||||||||| ||||| || ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41395114 |
tccagactcaatttcagcagaagtaagtgtcttctcataggtcacttgaaagttaaactcattatgagtgaaaggccttgga |
41395195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 41395285 - 41395332
Alignment:
| Q |
276 |
gatacggatgttgaacttccctaaccctacaaaaaccaatgttaccca |
323 |
Q |
| |
|
||||| ||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
41395285 |
gatactgattttgaacttcactaaccctacaaagaccaatgttaccca |
41395332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University