View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20381_high_20 (Length: 346)
Name: NF20381_high_20
Description: NF20381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20381_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 15 - 298
Target Start/End: Original strand, 32398975 - 32399257
Alignment:
| Q |
15 |
agagaatggaagggaagagaagcttgcgtatgtgctgtttatgcaatgaaagaagagcttctctcaagagacctaaaccctaaaccctagnnnnnnnncc |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32398975 |
agagaatggaagggaagagaagcgtgcgtatgtgctgtttatgcaatgaaagaagagcttctctcaagagacctaaaccctaaaccctagttttttt--c |
32399072 |
T |
 |
| Q |
115 |
atacgcacgaaacatgaatcaaatgctaaaaaagtcttaatattttccctnnnnnnncaaagaaagtcttaatattttactacttgaaccaata-nnnnn |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32399073 |
atacgcacgaaacatgaatcaaacgctaaaaaagtcttaatattttccctaaaaaaacaaaaaaagtcttaatattttactacttgaaccaatattttta |
32399172 |
T |
 |
| Q |
214 |
nnnnnnnnnggaaagatttggaccaactttactaaataaaccaacccggctaattgaaccgtgtcggagtctggttgagggagtg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32399173 |
tttttttttggaaagatttggaccaactttactaaataaaccaacccggctaattgaaccgtgttggagtctggttgagggagtg |
32399257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 55355292 - 55355368
Alignment:
| Q |
15 |
agagaatggaagggaagagaagcttgcgtatgtgctgtttatgcaatgaaagaagagcttctctcaagagacctaaa |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
55355292 |
agagaatggaagggaagagaagcttgcgtatgtgctgtttatgcaatgaaagaagagcttctctgaagagacctaaa |
55355368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University