View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20381_high_27 (Length: 311)

Name: NF20381_high_27
Description: NF20381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20381_high_27
NF20381_high_27
[»] chr6 (1 HSPs)
chr6 (18-83)||(3928813-3928878)


Alignment Details
Target: chr6 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 3928813 - 3928878
Alignment:
18 gaaagtattttaatgaatgatcaggacgctagggtcatgttgcatatggtcaatgccaagggtgac 83  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
3928813 gaaagtattttaatgaatgatcaggacgctagggtcatgttgcatatggtcaatgccaaggatgac 3928878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University