View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20381_high_29 (Length: 299)
Name: NF20381_high_29
Description: NF20381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20381_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 24831260 - 24830979
Alignment:
| Q |
1 |
aaaagtgtagccacttattattttgttggacatgtttgatgcaagnnnnnnnnnatttaatgaagaatcttccaatggacatgacaatgaaaaaatcaaa |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24831260 |
aaaagcgtagccacttattattttgttggacatgtttgatgcaagtttttttttatttaatgaagaatcttccaatggacatgacaatgaaaaaatcaaa |
24831161 |
T |
|
| Q |
101 |
tgtcatatgatacagatacagctgtgggggaaaaaattgtctctcattcaatggttgttccgattcgctagtagaaagggtaaggctcagcttcattcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24831160 |
tgtcatatgatacagatacagctgtggggaaaaaaattgtctctcattcaatggttgttccgattcgctagtagaaagggtaaggctcagcttcattcca |
24831061 |
T |
|
| Q |
201 |
tggatctatatgatacgaattggatgtctctgtgtacatttcattttacatgcatgcaaaatgagagcaaataatgattcat |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24831060 |
tggatctatatgatacgaattggatgtctctgtgtacatttcattttacatgcatgcaaaatgagagcaaataatgattcat |
24830979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 139 - 207
Target Start/End: Complemental strand, 815036 - 814968
Alignment:
| Q |
139 |
gtctctcattcaatggttgttccgattcgctagtagaaagggtaaggctcagcttcattccatggatct |
207 |
Q |
| |
|
||||| |||||||||||||| | |||||||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
815036 |
gtctcccattcaatggttgtgcagattcgctagtagaaacggtaaggctcaccttcatttcatggatct |
814968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 8 - 41
Target Start/End: Complemental strand, 16947436 - 16947403
Alignment:
| Q |
8 |
tagccacttattattttgttggacatgtttgatg |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16947436 |
tagccacttattattttgttggacatgtttgatg |
16947403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University