View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20381_high_36 (Length: 280)
Name: NF20381_high_36
Description: NF20381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20381_high_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 59 - 262
Target Start/End: Complemental strand, 41578429 - 41578226
Alignment:
| Q |
59 |
attgtttggttctttaaaagaaaaatgtttggtctaactatgccaatttatagtttaaaaattgttcattcttattcnnnnnnnngagagagagttcatt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41578429 |
attgtttggttctttaaaagaaaaatgtttggtctaactatgccaatttatagtttaaaaattgttcattcttattcttttttttgagagagagttcatt |
41578330 |
T |
|
| Q |
159 |
cttattcttagctgcgtcttcttgctccactctgtttttcattcttcacctttttccatttctccattgattctccttaatcaaccactacatgaagatt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41578329 |
cttattcttagctgcgtcttcttgctccactctgtttttcattcttcacctttttccatttctccattgattctccttaatcaaccactacatgaagatt |
41578230 |
T |
|
| Q |
259 |
cttt |
262 |
Q |
| |
|
|||| |
|
|
| T |
41578229 |
cttt |
41578226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University