View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20381_high_39 (Length: 256)

Name: NF20381_high_39
Description: NF20381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20381_high_39
NF20381_high_39
[»] chr7 (1 HSPs)
chr7 (1-240)||(42600330-42600569)


Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 42600330 - 42600569
Alignment:
1 actacaaacgagatgaaggacgtggagtgatgtatgcaagcaacaatgacttgtatagaaccaacgctgccagctggcatgattctctgcaagcgtggat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42600330 actacaaacgagatgaaggacgtggagtgatgtatgcaagcaacaatgacttgtatagaaccaacgctgccagctggcatgattctctgcaagcgtggat 42600429  T
101 ggcaccggaggcaccgaaagccgaggagttgccggagatttgtcgtaaggagatggttgaatgggattttcatgcggccggagttgctgaagtggttttt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42600430 ggcaccggaggcaccgaaagccgaggagttgccggagatttgtcgtaaggagatggttgaatgggattttcatgcggccggagttgctgaagtggttttt 42600529  T
201 gagttgctttctgaaggtttgggattggaacgtggaaagt 240  Q
    |||||||| |||||||||||||||||||||||||||||||    
42600530 gagttgctctctgaaggtttgggattggaacgtggaaagt 42600569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University