View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20381_high_46 (Length: 227)
Name: NF20381_high_46
Description: NF20381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20381_high_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 15176806 - 15176587
Alignment:
| Q |
7 |
ccgagtttctgaatgcgggaacagatacaacttcaacagcattggaatggatcatggcgaatttggtgaagtaccaagatatacaacaaaaacttgtaca |
106 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15176806 |
ccgagtttctaaatgcgggaacagatacaacttcaactgcattggaatggatcatggcgaatttggtgaagtaccaagatatacaagaaaaacttgtaca |
15176707 |
T |
|
| Q |
107 |
agagattaaaggggtgattggagatgataaaaaggagaaagaaattagagaagaagatttgnnnnnnntgccatatcttaaagctgtgattttggaaggg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
15176706 |
agagattaaaggggtgattggagatgataaaaaggagaaagaaattagagaagaagatttgaaaaaaatgccatatcttaaagctgtaattttggaaggg |
15176607 |
T |
|
| Q |
207 |
ctaagacggcatccaccgtt |
226 |
Q |
| |
|
||||| || ||||||||||| |
|
|
| T |
15176606 |
ctaaggcgtcatccaccgtt |
15176587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 73
Target Start/End: Original strand, 26506518 - 26506582
Alignment:
| Q |
9 |
gagtttctgaatgcgggaacagatacaacttcaacagcattggaatggatcatggcgaatttggt |
73 |
Q |
| |
|
|||||||| | ||| |||||||||||||||||||| ||||| || ||| | |||||||||||||| |
|
|
| T |
26506518 |
gagtttctcactgccggaacagatacaacttcaactgcattagagtgggttatggcgaatttggt |
26506582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 81
Target Start/End: Original strand, 2326873 - 2326945
Alignment:
| Q |
9 |
gagtttctgaatgcgggaacagatacaacttcaacagcattggaatggatcatggcgaatttggtgaagtacc |
81 |
Q |
| |
|
|||||| ||||||| || |||||||| ||||| || || ||| | ||||| |||||||||||||||||||||| |
|
|
| T |
2326873 |
gagtttttgaatgctggtacagatactacttccaccgctttgcattggattatggcgaatttggtgaagtacc |
2326945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 81
Target Start/End: Original strand, 2350894 - 2350966
Alignment:
| Q |
9 |
gagtttctgaatgcgggaacagatacaacttcaacagcattggaatggatcatggcgaatttggtgaagtacc |
81 |
Q |
| |
|
|||||| ||||||| || | |||||| ||||| || || ||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
2350894 |
gagtttttgaatgctgggatagatactacttccacggctttgcaatggattatggcaaatttggtgaagtacc |
2350966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University