View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20381_low_23 (Length: 336)
Name: NF20381_low_23
Description: NF20381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20381_low_23 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 5e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 217 - 336
Target Start/End: Complemental strand, 611014 - 610896
Alignment:
| Q |
217 |
gacaaaattaataacaagatctaataaaactttatcatgttcatgttatattctattcgtatcaaactctcttgtcttatcgatctctacaatatggtaa |
316 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
611014 |
gacaaaattaataacaagatctaataagactttatcatgttcatgttatattctatttgtatcaaactctcttgtcttatcgatctctacaatat-gcaa |
610916 |
T |
 |
| Q |
317 |
atatcaaataaactatttaa |
336 |
Q |
| |
|
|||||||| ||||||||||| |
|
|
| T |
610915 |
atatcaaacaaactatttaa |
610896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 17 - 101
Target Start/End: Complemental strand, 611217 - 611134
Alignment:
| Q |
17 |
tataaatcaattataattgttggattattaaaagtatttgattttaattnnnnnnnntcttaaaagtcacacatacaaatccctt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
611217 |
tataaatcaattataattgttggattattaaaagtatttgattttaatt-aaaaaaatcttaaaagtcacacatacaaatccctt |
611134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University