View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20381_low_29 (Length: 311)
Name: NF20381_low_29
Description: NF20381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20381_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 3928813 - 3928878
Alignment:
| Q |
18 |
gaaagtattttaatgaatgatcaggacgctagggtcatgttgcatatggtcaatgccaagggtgac |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3928813 |
gaaagtattttaatgaatgatcaggacgctagggtcatgttgcatatggtcaatgccaaggatgac |
3928878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University