View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20381_low_35 (Length: 290)
Name: NF20381_low_35
Description: NF20381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20381_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 38127217 - 38126939
Alignment:
| Q |
1 |
tgaaagatataaaaagcatatcaattaaacatttttgtgtgatgtgtaaatatgttttctagtaacggtctataccataatcatttaattgggaaagcct |
100 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38127217 |
tgaaagagctaaaaatcatatcaattaaacatttttgtgtgatgtgtaaatatgttttctagtaacggtctataccataatcatttaattggaaaagcct |
38127118 |
T |
 |
| Q |
101 |
tgatcattgatctccatatgcttcattattgaatccaattatagggtatcctgttgtggataatagatcctaatcttcttgacaatgtagtttcagggca |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38127117 |
tgatcattgatctccgtatgcttcattattgaatccaattatagggtatcctgttgtggataatagatcctaatcttcttgacaatgtagtttcagggca |
38127018 |
T |
 |
| Q |
201 |
agccacctttcactatgcaattagaagattcaaattgtagggtaaacactactaccccttttggttatgtattgcatga |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38127017 |
agccacctttcactatgcaattagaagattcaaattgtagggtaaacactactaccccttttagttatgtattgcatga |
38126939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University