View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20381_low_42 (Length: 254)
Name: NF20381_low_42
Description: NF20381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20381_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 245
Target Start/End: Original strand, 32532231 - 32532456
Alignment:
| Q |
20 |
gagtaagtgcccaaatcattgcatgcttagaatgtgaagtaccatcaaccacaaccataactctctttctcaccatcattccacaactctcttcatttcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32532231 |
gagtaagtgcccaaatcattgcatgcttagaatgtgaagtaccatcaaccacaaccataactctctttctcaccatcattccacaactctcttcatttcc |
32532330 |
T |
|
| Q |
120 |
atacatgttaatgttaaacccttccatttgactcaaatttgtctcacaagtcactcctaaactattgttgttgtatgtgttttttccactccacctattt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32532331 |
atacatgttaatgttaaacccttccatttgactcaaatttgtctcacaactcacccctaaactattgttgttgtatgtgttttttccactccacctattt |
32532430 |
T |
|
| Q |
220 |
gatgttgatttccaagtctcctttgc |
245 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32532431 |
gatgttgatttccaagtctcctttgc |
32532456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University