View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20381_low_47 (Length: 238)
Name: NF20381_low_47
Description: NF20381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20381_low_47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 17 - 235
Target Start/End: Original strand, 27133253 - 27133467
Alignment:
| Q |
17 |
acattgtgagtaattaattatacatattgtggtaaacnnnnnnnnggtggtgaaccttattttcttgttggtgattttgtggtaaaatcaatatgggatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27133253 |
acattgtgagtaattaattatacatattgtggtaaacttttttttggtggtgaaccttattttcttgttggtgattttgtggtaaaatcaatatgggatg |
27133352 |
T |
|
| Q |
117 |
aaattgtttgtgttgtttcattttcaaaatactcattcaactcgaaagtatctaacttatcatttcacttaattatactannnnnnnctttctttctgag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
27133353 |
aaattgtttgtgttgtttcattttcaaaatactcattcaactcgaaagtatctaacttatcatttcac----ttatactatttttttctttctttctgag |
27133448 |
T |
|
| Q |
217 |
atttgactattttagtaaa |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
27133449 |
atttgactattttagtaaa |
27133467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University