View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20381_low_49 (Length: 227)

Name: NF20381_low_49
Description: NF20381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20381_low_49
NF20381_low_49
[»] chr5 (1 HSPs)
chr5 (7-226)||(15176587-15176806)
[»] chr8 (1 HSPs)
chr8 (9-73)||(26506518-26506582)
[»] chr2 (2 HSPs)
chr2 (9-81)||(2326873-2326945)
chr2 (9-81)||(2350894-2350966)


Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 15176806 - 15176587
Alignment:
7 ccgagtttctgaatgcgggaacagatacaacttcaacagcattggaatggatcatggcgaatttggtgaagtaccaagatatacaacaaaaacttgtaca 106  Q
    |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
15176806 ccgagtttctaaatgcgggaacagatacaacttcaactgcattggaatggatcatggcgaatttggtgaagtaccaagatatacaagaaaaacttgtaca 15176707  T
107 agagattaaaggggtgattggagatgataaaaaggagaaagaaattagagaagaagatttgnnnnnnntgccatatcttaaagctgtgattttggaaggg 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||| ||||||||||||    
15176706 agagattaaaggggtgattggagatgataaaaaggagaaagaaattagagaagaagatttgaaaaaaatgccatatcttaaagctgtaattttggaaggg 15176607  T
207 ctaagacggcatccaccgtt 226  Q
    ||||| || |||||||||||    
15176606 ctaaggcgtcatccaccgtt 15176587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 73
Target Start/End: Original strand, 26506518 - 26506582
Alignment:
9 gagtttctgaatgcgggaacagatacaacttcaacagcattggaatggatcatggcgaatttggt 73  Q
    |||||||| | ||| |||||||||||||||||||| ||||| || ||| | ||||||||||||||    
26506518 gagtttctcactgccggaacagatacaacttcaactgcattagagtgggttatggcgaatttggt 26506582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 81
Target Start/End: Original strand, 2326873 - 2326945
Alignment:
9 gagtttctgaatgcgggaacagatacaacttcaacagcattggaatggatcatggcgaatttggtgaagtacc 81  Q
    |||||| ||||||| || |||||||| ||||| || || ||| | ||||| ||||||||||||||||||||||    
2326873 gagtttttgaatgctggtacagatactacttccaccgctttgcattggattatggcgaatttggtgaagtacc 2326945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 81
Target Start/End: Original strand, 2350894 - 2350966
Alignment:
9 gagtttctgaatgcgggaacagatacaacttcaacagcattggaatggatcatggcgaatttggtgaagtacc 81  Q
    |||||| ||||||| || | |||||| ||||| || || ||| ||||||| ||||| ||||||||||||||||    
2350894 gagtttttgaatgctgggatagatactacttccacggctttgcaatggattatggcaaatttggtgaagtacc 2350966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University