View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20382_high_31 (Length: 231)
Name: NF20382_high_31
Description: NF20382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20382_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 29 - 210
Target Start/End: Complemental strand, 43108798 - 43108617
Alignment:
| Q |
29 |
tgtttgaagctccaaatcataactattgccataaatcttacctaatgtgtttaaactatcagcttctttcattacttgcaaacatgnnnnnnnnnncttt |
128 |
Q |
| |
|
|||| |||||||||||||| |||| |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43108798 |
tgttagaagctccaaatcagaacttttgccagaaatcctacctaatgtgtttaaactatcagcttctttcattacttgcaaacatgttttttttttcttt |
43108699 |
T |
 |
| Q |
129 |
ctttctttgggttcatgtatatcatatttgatatgtattttatgggtgtatataattaattggcttaaatactcgaacaatc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43108698 |
ctttctttgggttcatgtatatcatatttgatatgtattttatgggtgtatataattaattggcttaaatactcaaacaatc |
43108617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University