View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20382_high_34 (Length: 211)
Name: NF20382_high_34
Description: NF20382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20382_high_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 195
Target Start/End: Original strand, 39484740 - 39484919
Alignment:
| Q |
16 |
cacagaagaaggttacaaggataaattgggctttgtagcaagaattccccaattgccataactagcggtgggaaatttgacnnnnnnnttgtcaggtaaa |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39484740 |
cacaaaagaaggttacaaggataaattgggctttgtagcaagaattccccaattgccataactagcggtgggaaatttgacaaaaaaattgtcaggtaaa |
39484839 |
T |
|
| Q |
116 |
aattctccacaatataaagaaaaatatgaaaagtagctttcggtagaagaaggaacatgaataagatcaccggagagggt |
195 |
Q |
| |
|
| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39484840 |
tagcctccacaatataaagaaaaatatcaaaaatagctttcggtagaagaaggaacatgaataagatcaccggagagggt |
39484919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 193
Target Start/End: Complemental strand, 40056570 - 40056522
Alignment:
| Q |
145 |
aaagtagctttcggtagaagaaggaacatgaataagatcaccggagagg |
193 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
40056570 |
aaagtagctttcggtagaagaaggagcatgaataggatcaccggagagg |
40056522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University