View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20382_low_33 (Length: 214)
Name: NF20382_low_33
Description: NF20382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20382_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 16 - 195
Target Start/End: Original strand, 5052062 - 5052243
Alignment:
| Q |
16 |
ggaggttggagaccaaatcattgagcatataaaaataatggaaccaaatccacaattaagccttctttatttgagtaaagacacaaaattt--caggata |
113 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| | ||| |
|
|
| T |
5052062 |
ggaggttggggaccaaatcagtgagcatataaaaataatggaaccaaatccgcaattaagccttctttatttgagtaaagacacaagtttttggaaaata |
5052161 |
T |
 |
| Q |
114 |
tcattcgtgcacaattgcatggactaatttttaagtcaggtaagaaacaatgttggatattagagtaacaaaatatttacct |
195 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5052162 |
tcattcgtgcataattgcatagactaattttcgagtcaggtaagaaacaatgttggatattagagtaacaaaatatttacct |
5052243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University