View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_100 (Length: 375)
Name: NF20384_high_100
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_100 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 24 - 363
Target Start/End: Original strand, 45068729 - 45069068
Alignment:
| Q |
24 |
gagttcgtgctacttgtaggccaatgttttgtctcttgttctaagtggagaatcatcaccatgaatgaggccaaaaccaattgcattgattgttcaaatc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45068729 |
gagttcgtgctacttgtaggccaatgttttgtctcttgttctaagtggagaatcatcaccatgaatgaggccaaaaccaattgcattgattgttcaaatc |
45068828 |
T |
|
| Q |
124 |
aatgcactggaagggaaaggggttactgtgtgtgtgaagtgcccttatcggcaataccttagttcaaggaaggaatattgattttctgcttctcaatgtg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45068829 |
aatgcactggaagggaaaggggttactgtgagtgtgaagtgcccttatcggcaataccttagttcaaggaaggaatattgattttctgcttctcaatgtg |
45068928 |
T |
|
| Q |
224 |
acttctctttttcttacataatcatttaagtggcccctttcttttctctttattacttgcaatttaagccacaaatacggttgctaaagcattcaagggc |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45068929 |
acttctctttttcttacataatcatttaagtggcccctttcttttctctttattacttgcaatttaagccacaaatacggttgctaaagcattcaagggc |
45069028 |
T |
|
| Q |
324 |
taattattaattatcagtagcttatttaccacaggttctg |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45069029 |
taattattaattatcagtagcttatttaccacatgttctg |
45069068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University