View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_149 (Length: 320)
Name: NF20384_high_149
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_149 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 160 - 309
Target Start/End: Complemental strand, 42432260 - 42432111
Alignment:
| Q |
160 |
gactcgaaatcacctctcttcatatttttctctccatttcaattnnnnnnngtgatttatatagatctaggttttttctttgtaatttcatcgtttgagt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42432260 |
gactcgaaatcacctctcttcatatttttctctctttttcaattaaaaaaagtgatttatatagatctaggttttttctttgtaatttcatcgtttgagt |
42432161 |
T |
 |
| Q |
260 |
gtgatgttgtattgttcagtgcttgtacgtcgttgtttgatattccatct |
309 |
Q |
| |
|
| | || |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42432160 |
gcggtgctgtattgttcggtgcttgtacgtcgttgtttgatattccatct |
42432111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 166 - 305
Target Start/End: Original strand, 42432803 - 42432944
Alignment:
| Q |
166 |
aaatcacctctcttcatatttttctctccatttcaattnnnnnnngtgattt--atatagatctaggttttttctttgtaatttcatcgtttgagtgtga |
263 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |||| || |||||||| |||||||||||||||| ||||| | || |||||| | |
|
|
| T |
42432803 |
aaatcacctctctttatatttttctctctatttcaatctaaaaaagtgaatttcatatagatttaggttttttctttgtgatttctttgtctgagtgcgg |
42432902 |
T |
 |
| Q |
264 |
tgttgtattgttcagtgcttgtacgtcgttgtttgatattcc |
305 |
Q |
| |
|
|| |||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
42432903 |
tgatgtattgttcggtgcctgtacgtcgttgtttgatattcc |
42432944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 7 - 65
Target Start/End: Complemental strand, 42432413 - 42432354
Alignment:
| Q |
7 |
tctctataacttatccctctc-aacaagttgaccttaaatttttcagtatgttttttctt |
65 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42432413 |
tctctataacttatccctctccaacaagttgaccttaaatttttcagtatgttttttctt |
42432354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 27267038 - 27267001
Alignment:
| Q |
165 |
gaaatcacctctcttcatatttttctctccatttcaat |
202 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
27267038 |
gaaatcacccctcttcatatttttctctctatttcaat |
27267001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 305
Target Start/End: Original strand, 43158908 - 43158969
Alignment:
| Q |
244 |
atttcatcgtttgagtgtgatgttgtattgttcagtgcttgtacgtcgttgtttgatattcc |
305 |
Q |
| |
|
||||||| ||||||||| | || ||||||||||||| ||| || ||| |||||||||||||| |
|
|
| T |
43158908 |
atttcatagtttgagtgcggtgatgtattgttcagtacttttatgtcattgtttgatattcc |
43158969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 215 - 262
Target Start/End: Complemental strand, 23425497 - 23425450
Alignment:
| Q |
215 |
tttatatagatctaggttttttctttgtaatttcatcgtttgagtgtg |
262 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||| ||| |||||| |
|
|
| T |
23425497 |
tttacatagatctaggttttttctttgtgatttcatcatttaagtgtg |
23425450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 28239739 - 28239776
Alignment:
| Q |
165 |
gaaatcacctctcttcatatttttctctccatttcaat |
202 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
28239739 |
gaaatcacctctcttcatctttttctctctatttcaat |
28239776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 4468513 - 4468546
Alignment:
| Q |
218 |
atatagatctaggttttttctttgtaatttcatc |
251 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
4468513 |
atatagatctaggttttttctttgtgatttcatc |
4468546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 35965153 - 35965116
Alignment:
| Q |
165 |
gaaatcacctctcttcatatttttctctccatttcaat |
202 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
35965153 |
gaaatcacctctcttcatctttttctctctatttcaat |
35965116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University