View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_154 (Length: 313)
Name: NF20384_high_154
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_154 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 287
Target Start/End: Complemental strand, 52005131 - 52004864
Alignment:
| Q |
20 |
tgtgggtggctaagggcgcgacagtttggatcctgagttgcgttgagctgctgttttcatgctgtttagctgctgacagtttaggttcagtgttttaggt |
119 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52005131 |
tgtgggtggctgagggcgcgacaatttggatcctgagttgcgttgagctgctgttttcatgctgtttagctgctgacagtttaggttcagtgttttaggt |
52005032 |
T |
|
| Q |
120 |
aatttgtgtgttgctgttgcctcacagttttggnnnnnnnnnagcttttggctgtgctgctatatcccacggttgtgtggtgatgttctgccatgccttt |
219 |
Q |
| |
|
| |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52005031 |
agtttgtgtgttgctgttgcctcacacttttgggttttttttagcttttggctgtgctgctatatcccacggttgtgtggtgatgttctgccatgccttt |
52004932 |
T |
|
| Q |
220 |
ttcccattgtattgctcttagccttttgtacttcttgtgcaaggcaagtaatgaatatatgctgtttc |
287 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52004931 |
ttcccattgtattgctcttagccttttctacttcttgtgcaaggcaagtaatgaatatatgttgtttc |
52004864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University