View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_174 (Length: 284)
Name: NF20384_high_174
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_174 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 2297321 - 2297168
Alignment:
| Q |
1 |
tcgagttccctttttgatatggtatccgcctattgtgcaatcttctgtgaattcgcgaggtgacgaaaatggagctggtggatagaatcttagtgtctct |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2297321 |
tcgagttccctttttgatatggtatccacctattgtgcaatcttctgtgaattcgcgaggtgacgaaaatggagctggtggatagaatcttagtgtctct |
2297222 |
T |
 |
| Q |
101 |
ttaattatagcatcaagatatactaatttattaacatctgactctcttacacaa |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2297221 |
ttaattatagcatcaagatatactaatttattaacatctgactctcttacacaa |
2297168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 2297104 - 2297048
Alignment:
| Q |
218 |
aatagtaaagacattgcccatgtaagtgttccagcggttgtgtcacttcctcctatg |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2297104 |
aatagtaaagacattgcccatgtaagtgttccagcggttgtgtcacttcctcctatg |
2297048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University