View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_185 (Length: 268)
Name: NF20384_high_185
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_185 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 14967064 - 14967312
Alignment:
| Q |
1 |
tccaaatcccggcagtggtggtggcggtggtggtagagttgcatcaacggttcatccatgaattcactaatgcatgaacgttatagctagacctagtatg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14967064 |
tccaaatcccagcagtggtggtggcggtggtggtagagttgcatcaacggttcatccatgaattcactaat-----aacgttatagctagacctagtatg |
14967158 |
T |
 |
| Q |
101 |
tggtttaatttgtgagcttgcgacgcttattaagatcgattttactactttctagccataaaaataagtgtgctgctgctagtaca-----cactggtag |
195 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14967159 |
tggtttaatttgcgagcttgcgacgcttattaagatcgattttactactttctagccataaaaataagtgtgctgctgctagtacactactcactggtag |
14967258 |
T |
 |
| Q |
196 |
cttgctacttggtatgtgaggggcttgtttagtgttttgcatctgatttaatttaat |
252 |
Q |
| |
|
||||||||||||||||||| |||||||||| || ||||||||||||||||||||| |
|
|
| T |
14967259 |
cttgctacttggtatgtga-tggcttgtttaatg--ttgcatctgatttaatttaat |
14967312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 14983148 - 14983388
Alignment:
| Q |
1 |
tccaaatcccggcagtggtggtggcggtggtggtagagttgcatcaacggttcatccatgaattcactaatgcatgaacgttatagctagacctagtatg |
100 |
Q |
| |
|
||||||||| |||||||||||||| |||||| |||| |||| ||| ||| ||||||||||||||| || |||||| | ||||||||||||||| | |
|
|
| T |
14983148 |
tccaaatcctggcagtggtggtggaggtggt---agagctgcagaaacagttaatccatgaattcactcatccatgaatgcaatagctagacctagttt- |
14983243 |
T |
 |
| Q |
101 |
tggtttaatttgtgagcttgcgacgcttattaagatcg-attttactactttctagccataaaaataagtgtgctgctgctagtacacactggtagcttg |
199 |
Q |
| |
|
|| | ||||||||| || || ||||||||||||| ||||||| |||||||||||| | |||||||||| || ||||||| |||||||| |
|
|
| T |
14983244 |
---ttgagtttgtgagcgtgtgattcttattaagatcgttttttactgctttctagccatgagaataagtgtg-------ta-cacacactagtagcttg |
14983332 |
T |
 |
| Q |
200 |
ctacttggtatgtg--aggggcttgttt-agtgttttgcatctgatttaatttaat |
252 |
Q |
| |
|
|||||||| ||||| || ||||||||| | ||||||||| ||| ||||||||||| |
|
|
| T |
14983333 |
ctacttgggatgtgtaagtggcttgtttaaatgttttgcagctgttttaatttaat |
14983388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University