View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20384_high_197 (Length: 254)

Name: NF20384_high_197
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20384_high_197
NF20384_high_197
[»] chr1 (1 HSPs)
chr1 (75-232)||(50761254-50761413)


Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 75 - 232
Target Start/End: Complemental strand, 50761413 - 50761254
Alignment:
75 ttgtgtctactacttgattgtttattatgacacttttt-atatgtatttgatagattgattggaaattaatacaaaatgcc-gtcagtattagtgtcatg 172  Q
    |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||    
50761413 ttgtgtctactacttgattgtttattatcacacttttttatatgtatttgatagattgattggaaattaatacaaaatgcccgtcagtatttgtgtcgtg 50761314  T
173 tctggtgtccgtatatgttttagtgcttcatacctacatatatgttgtgtctacttgctt 232  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
50761313 tctggtgtccgtatatgtttcagtgcttcatacctacatatatgttgtgtctacttgctt 50761254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University