View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_197 (Length: 254)
Name: NF20384_high_197
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_197 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 75 - 232
Target Start/End: Complemental strand, 50761413 - 50761254
Alignment:
| Q |
75 |
ttgtgtctactacttgattgtttattatgacacttttt-atatgtatttgatagattgattggaaattaatacaaaatgcc-gtcagtattagtgtcatg |
172 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| || |
|
|
| T |
50761413 |
ttgtgtctactacttgattgtttattatcacacttttttatatgtatttgatagattgattggaaattaatacaaaatgcccgtcagtatttgtgtcgtg |
50761314 |
T |
|
| Q |
173 |
tctggtgtccgtatatgttttagtgcttcatacctacatatatgttgtgtctacttgctt |
232 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50761313 |
tctggtgtccgtatatgtttcagtgcttcatacctacatatatgttgtgtctacttgctt |
50761254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University