View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20384_high_206 (Length: 251)

Name: NF20384_high_206
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20384_high_206
NF20384_high_206
[»] chr4 (1 HSPs)
chr4 (1-251)||(52763733-52763979)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 52763979 - 52763733
Alignment:
1 aagttggtttgctgatattgccacaaccactagaatcacataaaattttctgttgattgtccaaattgaacaaagtgatcagaaacactaaatagattat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||||| |||||||        
52763979 aagttggtttgctgatattgccacaaccactagaatcacataaaattttatgttgattgtccaaattgaacaaagtggtctgaaacacaaaataga---- 52763884  T
101 gtgatgata-taccaagccaatgaaaatatgatttgccaatattgccacaaccactaacacaaagttttgaattctggtaaatgatgcctcgtatgaaaa 199  Q
    || |  |   || ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52763883 gtcaaaacggtaacaa-ctaatgaaaatatgatttgccaatattgccacaaccactaacacaaagttttgaattctggtaaatgatgcctcgtatgaaaa 52763785  T
200 gattatccttggttaggaatccgattgtgaagaatacacgaaataaaaacac 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
52763784 gattatccttggttaggaatccgattgtgaagaatacacgaaataaaaacac 52763733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University