View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_215 (Length: 248)
Name: NF20384_high_215
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_215 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 229
Target Start/End: Complemental strand, 37533623 - 37533407
Alignment:
| Q |
14 |
caaaggcatgagaggatgataaccttttttcacgaacaattagagtcattatttatttacgctatttatggtactttttt-acacttaccacttactctt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37533623 |
caaaggcatgagaggatgataaccttttttcacgaacaattagagtcattatttacttatgctatttatggtactttttttacacttaccacttactctt |
37533524 |
T |
 |
| Q |
113 |
gtgatgattaatctcaggtatacatcattggaggggtcggagataaacgttattgcaacgacatttgggtgtttgacatacacacttgtttatggtctca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37533523 |
gtgatgattaatctcaggtatacatcattggaggggtcggagataaacgttattgcaacgacatttgggtgtttgacatacacacttgtttatggtctca |
37533424 |
T |
 |
| Q |
213 |
acttgatatacatggtc |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37533423 |
acttgatatacatggtc |
37533407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University