View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_224 (Length: 242)
Name: NF20384_high_224
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_224 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 69 - 242
Target Start/End: Complemental strand, 12145322 - 12145147
Alignment:
| Q |
69 |
tggcttctctacttgctgtaaaagatttttctccaattgaagacgctgaaactatcaagaatgcatgcaaaggttgtctttcttcaattttgttttgtca |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12145322 |
tggcttctctacttgctgtaaaagatttttctccaattgaagacgctgaaactatcaagaatgcatgcaaaggttgtctttcttcaattttgttttgtca |
12145223 |
T |
 |
| Q |
169 |
aagatt--ttatgtttctactttctaataatatttaacatattcatgtctaataacaaagggaatcaattttattc |
242 |
Q |
| |
|
|||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12145222 |
aagattgatgatgtttctactttctaataatacttaacatattcatgtctaataacaaagggaatcaattttattc |
12145147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University