View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_231 (Length: 238)
Name: NF20384_high_231
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_231 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 238
Target Start/End: Original strand, 2358074 - 2358304
Alignment:
| Q |
8 |
cggggacaaaattaattaagtgtggtaaagtagatagatttatctcgtggaggggtaatactnnnnnnnnncaatgtgtaggtaaatacataattgaaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2358074 |
cggggacaaaattaattaagtgtggtaaagtagatagatttatctcgtggaggggtaatactaaaaaaaaacaatgtgtaggtaaatacataattgaaat |
2358173 |
T |
 |
| Q |
108 |
gtcctcgactactttgttcttttgatacttgtgtacgtacttgcaaaacgaattaatgctactctgtatatatctcatcacgtacactctcaaccatatt |
207 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2358174 |
gtcctcgactacttggttcttttgatacttgtgtacgtacttgcaaaacgaattaatgctactctgtatatatctcatcacgtacactctcaaccatatt |
2358273 |
T |
 |
| Q |
208 |
tatttcttaatcaatggctatgtataatttc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2358274 |
tatttcttaatcaatggctatgtataatttc |
2358304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University