View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20384_high_241 (Length: 234)
Name: NF20384_high_241
Description: NF20384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20384_high_241 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 5 - 131
Target Start/End: Complemental strand, 37218468 - 37218342
Alignment:
| Q |
5 |
tctttgaagtttagcactctggaaagttatcaatgcaaaaccattaactgtatgaagggtgtttatgaaatgaaaaataagcttaattggtataggattt |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37218468 |
tctttgaagtttagcactccggaaagttatcaatgcaaaaccattaactgtatgaagggtgtttatgaaatgaaaaataagcttaattggtataggattt |
37218369 |
T |
 |
| Q |
105 |
ttggaggtctctgcagtgttgaccttc |
131 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37218368 |
ttggaggtctctgcagtgttgaccttc |
37218342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 5409478 - 5409411
Alignment:
| Q |
5 |
tctttgaagtttagcactctggaaagttatcaatgcaaaaccattaactgtatgaagggtgtttatga |
72 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| || ||| |||||||||||| ||||||| |
|
|
| T |
5409478 |
tctttgaagtttagcactccagaaagttatcaatgcaaaatcaataattgtatgaagggtatttatga |
5409411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 217
Target Start/End: Complemental strand, 37218308 - 37218239
Alignment:
| Q |
150 |
agtgttgacctttttaagtatgtggagta--nnnnnnngcaagttgttgtggagcaatctggagtatata |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
37218308 |
agtgttgacctttttaagtatgtggagtatttttttttgcaagttgttctggagcaatctggagtatata |
37218239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University